<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD with MathML3 v1.3 20210610//EN" "https://jats.nlm.nih.gov/publishing/1.3/JATS-journalpublishing1-3-mathml3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" article-type="research-article" dtd-version="1.3" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">JEN</journal-id>
      <journal-title-group>
        <journal-title>Journal of Enzymes</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2690-4829</issn>
      <publisher>
        <publisher-name>Open Access Pub</publisher-name>
        <publisher-loc>United States</publisher-loc>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.14302/issn.2690-4829.jen-18-2048</article-id>
      <article-id pub-id-type="publisher-id">JEN-18-2048</article-id>
      <article-categories>
        <subj-group>
          <subject>research-article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Using A “Superrooting”Cultivar of Taxus Chinensis Var. Mairei to Unravel Antioxidative Enzymes’ and Micrornas’ Role on Adventitious Rooting</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Wei</surname>
            <given-names>Tang</given-names>
          </name>
          <xref ref-type="aff" rid="idm1841819588">1</xref>
          <xref ref-type="aff" rid="idm1841825996">2</xref>
          <xref ref-type="aff" rid="idm1841825780">*</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid">https://orcid.org/0000-0003-2032-5980</contrib-id><name>
            <surname>Yongjun</surname>
            <given-names>Fei</given-names>
          </name>
          <xref ref-type="aff" rid="idm1841819588">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1841819588">
        <label>1</label>
        <addr-line>College of Horticulture and Gardening, Yangtze University, Jingzhou, Hubei Province 434025, People’s Republic of China.</addr-line>
      </aff>
      <aff id="idm1841825996">
        <label>2</label>
        <addr-line>Program of Cellular and Molecular Biology, Duke University, Durham, NC 27708, USA.</addr-line>
      </aff>
      <aff id="idm1841825780">
        <label>*</label>
        <addr-line>corresponding author</addr-line>
      </aff>
      <contrib-group>
        <contrib contrib-type="editor">
          <name>
            <surname>Mezni</surname>
            <given-names>Ali</given-names>
          </name>
          <xref ref-type="aff" rid="idm1841942500">1</xref>
        </contrib>
      </contrib-group>
      <aff id="idm1841942500">
        <label>1</label>
        <addr-line>Department of Life Sciences, University of Carthag </addr-line>
      </aff>
      <author-notes>
        <corresp>
    
    Wei Tang, <addr-line>College of Horticulture and Gardening, Yangtze University, </addr-line><addr-line>Jingzhou</addr-line><addr-line>, Hubei Province 434025, People’s Republic of China. Program of Cellular and Molecular Biology, Duke University, Durham, NC 27708, USA</addr-line> ,Tel: <phone>+86-13921074062</phone>, Fax: <fax>+86-716-8066262</fax>, E-mail: <email>wt10yu604@gmail.com</email></corresp>
        <fn fn-type="conflict" id="idm1850786412">
          <p>The authors have declared that no competing interests exist.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub" iso-8601-date="2018-05-18">
        <day>18</day>
        <month>05</month>
        <year>2018</year>
      </pub-date>
      <volume>1</volume>
      <issue>2</issue>
      <fpage>1</fpage>
      <lpage>18</lpage>
      <history>
        <date date-type="received">
          <day>24</day>
          <month>12</month>
          <year>2016</year>
        </date>
        <date date-type="accepted">
          <day>28</day>
          <month>03</month>
          <year>2017</year>
        </date>
        <date date-type="online">
          <day>18</day>
          <month>05</month>
          <year>2018</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© </copyright-statement>
        <copyright-year>2018</copyright-year>
        <copyright-holder>Wei Tang, et al.</copyright-holder>
        <license xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="http://openaccesspub.org/jen/article/764">This article is available from http://openaccesspub.org/jen/article/764</self-uri>
      <abstract>
        <p>Rooting of cuttings is very important for production of economically important plants. We produced thousands of plantlets in <italic>Taxus </italic><italic>chinensis</italic>var. <italic>mairei</italic> using the technology of rooting of cuttings and identified two types of rooted cuttings, one with low rate of root formation and another with high rate of root formation. To determine the physiological role of antioxidative enzymes and microRNAs during the process of rooting, we measured the levels of these antioxidative enzymes and microRNAs in the stem portion, needles, roots, and basal portion of cuttings. Compared to the cuttings with low rate of root formation, cuttings with high rate of root formation had higher expression of polyphenoloxidase (<italic>PPO</italic>), catalase  (CAT), peroxidase (<italic>POD</italic>), ascorbate peroxidase (APOX), glutathione reductase (GR), and superoxide dismutase (SOD) in the adventitious roots and basal portion of the rooted cuttings 77 days after planting.  In the basal portion of cuttings, the content of thiobarbituric acid reactive substances (TBARS) and total phenols were decreased and the content of antioxidants was increased, but they did not change in the needles of cuttings during planting. Analysis of microRNAs by quantitative realtime PCR demonstrated that expression of miR162, miR408, and miR857 increases in the basal portion of cuttings, but not in the stem portion of cuttings, 77 days after planting. Expression of miR408 and miR857 were also increased in the needles of cuttings 77 days after planting. Changes of these antioxidative enzymes and microRNAs associated with the rooting features of <italic>T. </italic><italic>chinensis</italic>var. <italic>mairei</italic>cuttings and their functions have been discussed.</p>
      </abstract>
      <kwd-group>
        <kwd>Antioxidative enzymes</kwd>
        <kwd>basal portion of cuttings</kwd>
        <kwd>microRNAs</kwd>
        <kwd>root formation</kwd>
        <kwd>Taxus chinensis  var. mairei</kwd>
      </kwd-group>
      <counts>
        <fig-count count="5"/>
        <table-count count="0"/>
        <page-count count="18"/>
      </counts>
    </article-meta>
  </front>
  <body>
    <sec id="idm1841684868" sec-type="intro">
      <title>Introduction</title>
      <p>Rooting of cuttings is very important for large-scale propagation of economically important plant species <xref ref-type="bibr" rid="ridm1850761900">1</xref>,<xref ref-type="bibr" rid="ridm1850766364">2</xref>,<xref ref-type="bibr" rid="ridm1850776676">3</xref>,<xref ref-type="bibr" rid="ridm1850839044">4</xref>. Efficient propagation of these economically important plants is dependent on the efficiency of adventitious root formation in cuttings <xref ref-type="bibr" rid="ridm1850628844">5</xref>,<xref ref-type="bibr" rid="ridm1850625748">6</xref>,<xref ref-type="bibr" rid="ridm1850631076">7</xref>.  Cuttings of Taxus chinensis var. mairei are recalcitrant to root. The detailed cause of their low rooting ability is not clear. In general, environmental conditions and endogenous biochemical compounds are considered to affect adventitious root formation <xref ref-type="bibr" rid="ridm1850620388">8</xref>,<xref ref-type="bibr" rid="ridm1850615348">9</xref>,<xref ref-type="bibr" rid="ridm1850607148">10</xref>,<xref ref-type="bibr" rid="ridm1850612620">11</xref>. Among the endogenous compounds, proteins, enzymes, and phytohormones have been used for the efficient propagation of cuttings in many horticultural and forestry plants <xref ref-type="bibr" rid="ridm1850615348">9</xref>,<xref ref-type="bibr" rid="ridm1850593452">12</xref>,<xref ref-type="bibr" rid="ridm1850589636">13</xref>. </p>
      <p>Taxus is a world wide economically important and an endangered gymnosperm                                             genus <xref ref-type="bibr" rid="ridm1850625748">6</xref>,<xref ref-type="bibr" rid="ridm1850631076">7</xref>,<xref ref-type="bibr" rid="ridm1850586252">14</xref>,<xref ref-type="bibr" rid="ridm1850598924">15</xref>,<xref ref-type="bibr" rid="ridm1850596764">16</xref>,<xref ref-type="bibr" rid="ridm1850575316">17</xref>,<xref ref-type="bibr" rid="ridm1850572580">18</xref>,<xref ref-type="bibr" rid="ridm1850570780">19</xref>.  The barks of these plants are very valuable anticancer medicinal resource such as the powerful anticancer agent paclitaxel <xref ref-type="bibr" rid="ridm1850568764">20</xref>.  Efficient propagation of these plants is critical to the scientific investigation and practical application in the field of conifer biotechnology <xref ref-type="bibr" rid="ridm1850625748">6</xref>,<xref ref-type="bibr" rid="ridm1850586252">14</xref>,<xref ref-type="bibr" rid="ridm1850572580">18</xref>,<xref ref-type="bibr" rid="ridm1850570780">19</xref>,<xref ref-type="bibr" rid="ridm1850563436">21</xref>. It has been reported that anticancer agents have been obtained in samples of Taxus wallichiana var. mairei <xref ref-type="bibr" rid="ridm1850628844">5</xref> and Taxus x media var. Hicksii <xref ref-type="bibr" rid="ridm1850625748">6</xref>. In addition, the endophytic fungi in the bark of Taxus wallichiana var. mairei have been used to produce 10-deacetyl baccatin III <xref ref-type="bibr" rid="ridm1850560124">22</xref>. Investigations of transcriptome and metabolome in plants of Taxus genus demonstrated that difference in gene expression is related to the plant tissue type <xref ref-type="bibr" rid="ridm1850554540">23</xref>. However, biochemical and genetic studies in T. chinensis var. mairei are relatively rare because of lack of high efficient propagation system. </p>
      <p>Antioxidative enzymes are known to affect morphogenesis in plants <xref ref-type="bibr" rid="ridm1850549284">24</xref><xref ref-type="bibr" rid="ridm1850546764">25</xref><xref ref-type="bibr" rid="ridm1850541868">26</xref><xref ref-type="bibr" rid="ridm1850527236">27</xref><xref ref-type="bibr" rid="ridm1850525652">28</xref><xref ref-type="bibr" rid="ridm1850522916">29</xref><xref ref-type="bibr" rid="ridm1850519964">30</xref><xref ref-type="bibr" rid="ridm1850533788">31</xref><xref ref-type="bibr" rid="ridm1850509556">32</xref><xref ref-type="bibr" rid="ridm1850507180">33</xref><xref ref-type="bibr" rid="ridm1850502428">34</xref>. In the in vitro culture of many plant species, antioxidative enzymes can be biomarkers of adventitious root formation from microshoots <xref ref-type="bibr" rid="ridm1850549284">24</xref>,<xref ref-type="bibr" rid="ridm1850546764">25</xref> ,<xref ref-type="bibr" rid="ridm1850527236">27</xref>,<xref ref-type="bibr" rid="ridm1850525652">28</xref>,<xref ref-type="bibr" rid="ridm1850522916">29</xref>,<xref ref-type="bibr" rid="ridm1850519964">30</xref>,<xref ref-type="bibr" rid="ridm1850533788">31</xref>. On the other hand, antioxidative enzymes have regulatory effect on adventitious root formation in shoot culture of a large number of plant species <xref ref-type="bibr" rid="ridm1850501780">35</xref>,<xref ref-type="bibr" rid="ridm1850496596">36</xref>,<xref ref-type="bibr" rid="ridm1850495084">37</xref>,<xref ref-type="bibr" rid="ridm1850489900">38</xref>,<xref ref-type="bibr" rid="ridm1850486876">39</xref>,<xref ref-type="bibr" rid="ridm1850483852">40</xref>,<xref ref-type="bibr" rid="ridm1850514668">41</xref>,<xref ref-type="bibr" rid="ridm1850512292">42</xref>,<xref ref-type="bibr" rid="ridm1850463772">43</xref>,<xref ref-type="bibr" rid="ridm1850461972">44</xref>,<xref ref-type="bibr" rid="ridm1850456284">45</xref> and in Vitis vinifera cuttings <xref ref-type="bibr" rid="ridm1850455420">46</xref>,<xref ref-type="bibr" rid="ridm1850452036">47</xref>,<xref ref-type="bibr" rid="ridm1850450452">48</xref>,<xref ref-type="bibr" rid="ridm1850444548">49</xref>. The above research results indicate that antioxidative enzymes are involved in adventitious root formation. Although the effect of some antioxidative enzymes adventitious root formation has been confirmed in plants <xref ref-type="bibr" rid="ridm1850522916">29</xref>,<xref ref-type="bibr" rid="ridm1850519964">30</xref>,<xref ref-type="bibr" rid="ridm1850533788">31</xref>,<xref ref-type="bibr" rid="ridm1850509556">32</xref>,<xref ref-type="bibr" rid="ridm1850507180">33</xref>, <xref ref-type="bibr" rid="ridm1850442172">50</xref>, <xref ref-type="bibr" rid="ridm1850439076">51</xref> physiological role of polyphenoloxidase (PPO), catalase  (CAT), peroxidase (POD), ascorbate peroxidase (APOX), glutathione reductase (GR), and superoxide dismutase (SOD) during the process of in vitro rooting in T. chinensis var. mairei cuttings has not reported.</p>
      <p>MicroRNAs are known to affect morphogenesis in plants <xref ref-type="bibr" rid="ridm1850435188">52</xref>,<xref ref-type="bibr" rid="ridm1850465716">53</xref>,<xref ref-type="bibr" rid="ridm1850407396">54</xref>,<xref ref-type="bibr" rid="ridm1850405380">55</xref>. However, the effect of microRNAs on adventitious root formation might be more complicated because the composition and concentration vary with the species                   and growth phase <xref ref-type="bibr" rid="ridm1850589636">13</xref>,<xref ref-type="bibr" rid="ridm1850404300">56</xref>,<xref ref-type="bibr" rid="ridm1850398972">57</xref>,<xref ref-type="bibr" rid="ridm1850396596">58</xref>,<xref ref-type="bibr" rid="ridm1850392420">59</xref>,<xref ref-type="bibr" rid="ridm1850387452">60</xref>,<xref ref-type="bibr" rid="ridm1850384284">61</xref>,<xref ref-type="bibr" rid="ridm1850381764">62</xref>. The functions of microRNAs and their mechanisms in regulating plant growth and development are still unclear <xref ref-type="bibr" rid="ridm1850435188">52</xref>, <xref ref-type="bibr" rid="ridm1850465716">53</xref>, <xref ref-type="bibr" rid="ridm1850377588">63</xref>, <xref ref-type="bibr" rid="ridm1850366100">64</xref>. Although the effect of some microRNAs on adventitious root formation has been confirmed and miR162, miR408, and miR857 have been reported to be involved in root initiation and growth in some plant species including model plants and crop plants <xref ref-type="bibr" rid="ridm1850761900">1</xref>,<xref ref-type="bibr" rid="ridm1850766364">2</xref>,<xref ref-type="bibr" rid="ridm1850435188">52</xref>,<xref ref-type="bibr" rid="ridm1850465716">53</xref>,<xref ref-type="bibr" rid="ridm1850407396">54</xref>,<xref ref-type="bibr" rid="ridm1850405380">55</xref>,<xref ref-type="bibr" rid="ridm1850377588">63</xref>,<xref ref-type="bibr" rid="ridm1850366100">64</xref>,<xref ref-type="bibr" rid="ridm1850361420">65</xref>,<xref ref-type="bibr" rid="ridm1850359116">66</xref> physiological role of microRNAs miR162, miR408, and miR857 during the process of in vitro rooting in T. chinensis var. mairei cuttings remains to be determined. Therefore, we examined the expression of miR162, miR408, and miR857 during the process of in vitro rooting in T. chinensis var. mairei cuttings. </p>
      <p>The aim of this study is to elucidate the effect of antioxidative enzymes PPO, CAT, POD, APOX, GR, and SOD and microRNAs miR162, miR408, and miR857 on the rooting ability of cuttings of T. chinensis var. mairei. Expression levels of PPO, CAT, POD, APOX, GR, SOD, miR162, miR408, and miR857 in the stem portion, needle, roots, and basal portion of cuttings with high rate of root formation were compared with those of cuttings with low rate of root formation. </p>
    </sec>
    <sec id="idm1841606980" sec-type="materials">
      <title>Materials and Methods</title>
      <sec id="idm1841607340">
        <title>Plant Material and Cuttings</title>
        <p>Taxus chinensis var. mairei <sup>genotypes Baokang</sup> was planted in a research field at Yangtze University and used in this experiment. Cuttings with 16 needles were obtained from these trees in early spring of the year and stored horizontally at 4<sup>o</sup>C in a plastic bag until cutting. Cuttings with one stem were prepared and cuttings with similar length and basal end diameter were planted in vermiculite in a planting box and placed in an unheated glasshouse. They were watered with 0.5-liter tap water per planting box every 3 days. Observations on rooting were made at 77 days after planting during each year. All cuttings with roots (&gt;1 mm) were classified as rooted cuttings, and the roots (&gt;1 mm) were used to prepare samples for analysis of antioxidative enzymes and micro RNA expression. </p>
      </sec>
      <sec id="idm1841606548">
        <title>Sample Preparation for Antioxidative Enzymes and microRNAs Analyses</title>
        <p>The number of cuttings used for antioxidative enzymes and microRNAs analyses were 756 (NR) and 649 (SR), respectively. The stem portion, needle, roots, and basal portions (2 cm) were collected from the cuttings on the planting day (day 0) and 77 days after planting. Each sample was chopped into small pieces with scissors, immediately frozen in liquid nitrogen, and then stored at −80<sup>o</sup>C until analysis. The levels of antioxidative enzymes and microRNAs were measured from samples of the stem portion, needles, roots, and basal portion of cuttings, respectively. </p>
      </sec>
      <sec id="idm1841605756">
        <title>Thiobarbituric Acid Reactive Substances (TBARS) Determination</title>
        <p>Lipid peroxidation was determined as the amount of thiobarbituric acid reactive substances (TBARS) measured by the thiobarbituric acid (TBA) reaction as described previously <xref ref-type="bibr" rid="ridm1850358396">67</xref>,<xref ref-type="bibr" rid="ridm1850354508">68</xref>,<xref ref-type="bibr" rid="ridm1850352924">69</xref>. Samples of stem portion, needle, roots, and basal portions (2 cm) of T. chinensis var. mairei cuttings were homogenized in 3 ml of 20 % (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 2,655 g for 20 min and mixed with 20 % TCA containing 0.5 % (w/v) TBA and100 ml 4 % BHT in ethanol at 1:1. After the extracts of plant tissues were heated at 95 <sup>o</sup>C for 30 min, they were cooled on ice for 5 minutes, centrifuged at 10,000 g for 15 min. The absorbance the extracts of different samples was measured at 532 nm. The control of             non-specific absorption at 600 nm was subtracted from the samples. The value of TBARS was calculated using the method described previously <xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850358396">67</xref>,<xref ref-type="bibr" rid="ridm1850351556">70</xref>.</p>
      </sec>
      <sec id="idm1841603092">
        <title>Measurement of Total Phenols </title>
        <p>Analysis of phenols was conducted after harvested the samples. Samples (1 g) of stem portion, needle, roots, and basal portions (2 cm) of T. chinensis var. mairei cuttings were homogenized in 50mL cold 80% methanol using a biomixer (Nihonseiki, Tokyo). Samples were washed twice with 50mL of 80% methanol and filtered. 150mL of distilled water was added to the samples to obtain a crude extract of the phenols.The total phenols  content was determined using the Folin-Ciocalteu method <xref ref-type="bibr" rid="ridm1850455420">46</xref>,<xref ref-type="bibr" rid="ridm1850345652">71</xref>,<xref ref-type="bibr" rid="ridm1850343420">72</xref>,<xref ref-type="bibr" rid="ridm1850339316">73</xref>]. After elimination of methanol in the crude extracts (180 mL) in vacuo, the aqueous phase was diluted five times with distilled water to the final volume of 900 mL. The diluted sample was mixed with 1N Folin-Ciocalteu reagent and then with 10% sodium carbonate 3 min later and placed at room temperature in darkness for 1 h. The absorbance of the reactants at 530 nm was measured. The total concentration of phenolic compounds was estimated by a standard curve obtained with chlorogenic acid (Wako Pure Chemical, Osaka).</p>
      </sec>
      <sec id="idm1841600716">
        <title>Determination of Total Antioxidant Levels </title>
        <p>Total antioxidant levels were determined from samples (300 mg) of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings using an antioxidant assay kit (Sigma–Aldrich) following the product manual. Antioxidant reactions were performed in a 96-well plate by reading endpoint absorbance at 405 nm using a plate reader (BioTek, Synergy 2, Winooski, VT, USA).</p>
      </sec>
      <sec id="idm1841600644">
        <title>Measurement of Antioxidative Enzymes </title>
        <p>Analysis of PPO, CAT, and POD activity was conducted by following the previous protocol <xref ref-type="bibr" rid="ridm1850522916">29</xref>,<xref ref-type="bibr" rid="ridm1850533788">31</xref>,<xref ref-type="bibr" rid="ridm1850509556">32</xref>,<xref ref-type="bibr" rid="ridm1850502428">34</xref>,<xref ref-type="bibr" rid="ridm1850442172">50</xref>,<xref ref-type="bibr" rid="ridm1850398972">57</xref>,<xref ref-type="bibr" rid="ridm1850369844">74</xref>,<xref ref-type="bibr" rid="ridm1850324692">75</xref>. Samples (6 g) of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings were immersed in 100mL of cold 80% methanol containing 1mM butylated               hydroxytoluene (BHT) and 0.01% ascorbic acid and stirred for 24 h at 4<sup>o</sup>C. Activity of antioxidant enzymes PPO was measured by following the modified methods previously described <xref ref-type="bibr" rid="ridm1850502428">34</xref>. The activity of CAT was determined spectrophotometrically as previously described <xref ref-type="bibr" rid="ridm1850439076">51</xref>. The decomposition of 1 mmol H<sub>2</sub>O<sub>2</sub> per gram FW in 1 min was defined as one unit. The activity of POD was determined according to the procedure <xref ref-type="bibr" rid="ridm1850509556">32</xref>,<xref ref-type="bibr" rid="ridm1850439076">51</xref>, with a Shimadzu UV-120IV spectrophotometer. The amount of POD catalyzing the oxidation of 1 mol guaiacol in 1 min was defined as one unit. The activities of APOX, GR, and SOD were determined as described previously <xref ref-type="bibr" rid="ridm1850486876">39</xref>,<xref ref-type="bibr" rid="ridm1850514668">41</xref>,<xref ref-type="bibr" rid="ridm1850512292">42</xref>,<xref ref-type="bibr" rid="ridm1850463772">43</xref>. Two grams of control and sampes of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings were homogenized under ice-cold conditions in 3 ml of extraction buffer, consisting of 50 mM phosphate buffer (pH 7.4), 1 mM EDTA, 1 g PVP, and0.5 % (v/v) Triton            X-100 at 4 <sup>o</sup>C. The extracts were centrifuged at 10,000 ´ g for 20 min. The supernatant was used to determine the enzyme activity. APOX activity was measured immediately in fresh extracts and was assayed as described <xref ref-type="bibr" rid="ridm1850461972">44</xref>. GR activity was determined by following the decrease in absorbance at 340 nm due to NADPH oxidation [42]. SOD activity was measured by the inhibition of the photochemical reduction of NBT, as described <xref ref-type="bibr" rid="ridm1850486876">39</xref>, <xref ref-type="bibr" rid="ridm1850483852">40</xref>. </p>
      </sec>
      <sec id="idm1841582276">
        <title>Total RNA isolation and Quantitative RealTime PCR (qPCR)</title>
        <p>Total RNA was isolated from frozen samples of stem portion, needle, roots, and basal portions of T. chinensis var. mairei cuttings using TRIzol reagent according to the manufacturer’s protocol (Invitrogen). The high quality cDNA were prepared using a TaqMan® MicroRNA Reverse Transcription Kit                                (Applied Biosystems). For miRNA expression analysis, TaqMan® MicroRNA Assays (Applied Biosystems) are carried out to amplify RNAs for quantitation of miRNAs. The controls used were as suggested by the manufacturer’s manual. The U6 gene was used as an internal control. Samples were examined in triplicate on the Applied Biosystems 7900HT System, according to the manufacturer’s manual. </p>
      </sec>
      <sec id="idm1841582924">
        <title>Analysis of Expression of microRNAs </title>
        <p>For the analysis of microRNAs                            (miR162, miR408, and miR857) in samples, the extraction procedure was used as previously described <xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>,<xref ref-type="bibr" rid="ridm1850465716">53</xref>,<xref ref-type="bibr" rid="ridm1850407396">54</xref>,<xref ref-type="bibr" rid="ridm1850405380">55</xref>,<xref ref-type="bibr" rid="ridm1850396596">58</xref>, <xref ref-type="bibr" rid="ridm1850387452">60</xref>,<xref ref-type="bibr" rid="ridm1850384284">61</xref>,<xref ref-type="bibr" rid="ridm1850354508">68</xref>,<xref ref-type="bibr" rid="ridm1850322388">76</xref>. Two specific primers were used to amplify each of miRNAs.                              Primers used for Real-Time PCR are R1: 5’-AGTGGTTTATCGATCTCTTCCTTG-3’ and F1:                           5’-GTGGTTCAAGCGTTTTATTGTTG-3’ for miR162, R2:     5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCATGCT-3’ and F2:5’-TCAGCACAGGGAACAAGCAG-3’ for miR408, and R3:5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATACAC-3’ and </p>
        <p>F3: 5’-GCGGCGTTTTGTATGTTGAAG-3’ for miR857</p>
      </sec>
      <sec id="idm1841577884">
        <title>Statistical Analyses</title>
        <p>Mean values were used to determine the significant differences among different groups with the Least Significant Difference test at 5% level of probability. Statistic analysis of data was performed by Student’s     t-test or one-way ANOVA using GraphPad Prism 6 (GraphPad Software Inc., CA).</p>
      </sec>
    </sec>
    <sec id="idm1841578676" sec-type="results">
      <title>Results</title>
      <sec id="idm1841577812">
        <title>Adventitious Root Formation in Cuttings of Taxus chinensis var. mairei </title>
        <p>During the in vitro rooting process in T. chinensis var. mairei, we used two different genotypes of T. chinensis, one with normal rooting and the other with super rooting phenotypes, which originated from sampling at two sites. Cuttings of T. chinensis with normal rooting (NR) are from BaoKang. Cuttings of T. chinensis with super rooting (SR) are from Jingzhou. 3436 cuttings of Baokang were planted at day zero and 756 cuttings of them actually rooted. 832 cuttings of Jingzhou were planted at day zero and 649 cuttings of them actually rooted at 77 days of in vitro rooting. Rooted cuttings (Baokang, 756 plantlets) has low rate of adventitious root formation [named normal rooting (NR) cuttings, <xref ref-type="fig" rid="idm1842524012">Figure 1</xref>a], and another type of rooted cuttings (Jinzhou, 649 plantlets) has high rate of adventitious root formation [named super rooting (SR) cuttings,              <xref ref-type="fig" rid="idm1842524012">Figure 1</xref>b]. To determine the difference of these two types of rooted cuttings, percentage of rooting types (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>c), number of adventitious roots per cuttings (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>d), number of branch per cuttings (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>e), and growth rate (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>f) were measured. Our results demonstrated that percentage of rooting in super rooting cuttings is 3.9 fold higher than in normal rooting cuttings (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>c). There are 3.7 fold increase in number of adventitious roots per cuttings (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>d), 2.1 fold increase in branch number per cuttings (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>e), and 2.6 fold increase in growth rate (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>f) in rooted cuttings with high rate of adventitious root formation, compared to rooted cuttings with low rate of adventitious root formation. Our results indicated that number of adventitious roots (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>d) and number of branch (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>e), as well as growth rate (<xref ref-type="fig" rid="idm1842524012">Figure 1</xref>f), are significantly increased in rooted cuttings with high rate of adventitious root formation 77 days after planting.</p>
        <fig id="idm1842524012">
          <label>Figure 1.</label>
          <caption>
            <title> Adventitious root formation in cuttings of Taxus chinensis var. mairei. During the in vitro rooting process in T. chinensis, we identified two genotypes of rooted cuttings at 77 days of in vitro rooting. One type of rooted cuttings has low rate of root formation with low number of adventitious roots and lateral roots (Fig. 1a, normal rooting cuttings), another type of rooted cuttings has high rate of root formation with high number of adventitious roots and lateral roots (Fig. 1b, super rooting cuttings). Percentage of rooting types (Fig. 1c), Number of adventitious roots per cuttings (Fig. 1d), number of branch per cuttings (Fig. 1e), and growth rate (Fig. 1f) were measured for rooted cuttings. The statistically significant difference between groups was determined by one-way ANOVA. Data are presented as means of five independent experiments. Error bars represent standard error. The asterisk indicates significant differences compared to the rooted cuttings with low rate of root formation, as assessed by a t-test. ***P&lt;0.001, significant relative to control. Vertical bars indicate standard error.</title>
          </caption>
          <graphic xlink:href="images/image1.jpeg" mime-subtype="jpeg"><alt-text>Figure 1. Adventitious root formation in cuttings of Taxus chinensis var. mairei.</alt-text></graphic>
        </fig>
      </sec>
      <sec id="idm1841557916">
        <title>TBARS, Total Phenols, And Antioxidants Content in Shoot Cuttings</title>
        <p>To evaluate the effect of TBARS, total phenols, and antioxidants content on root formation, TBARS, total phenols, and antioxidants content in different portions of rooted cuttings of T. chinensis var. mairei was determined at 0 and 77 days after planting.TBARS (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>a, <xref ref-type="fig" rid="idm1842517172">Figure 2</xref>b, and <xref ref-type="fig" rid="idm1842517172">Figure 2</xref>c), total phenols  (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>d,<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>e, and <xref ref-type="fig" rid="idm1842517172">Figure 2</xref>f), and antioxidants content (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>g,<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>h, and <xref ref-type="fig" rid="idm1842517172">Figure 2</xref>i) was measured from samples of stem portion, basal portion, and needles of rooted cuttings, respectively. Our results demonstrated that TBARS was significantly lower from day 0 to day 77 after planting in stem portion (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>a) and basal portion (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>b) of both NR cuttings and SR cuttings, total phenol was significantly higher from day 0 to day 77 after planting in stem portion (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>d), but was significantly lower from day o to day 77 of planting in basal portion (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>e) of both NR cuttings and SR cuttings. Content of antioxidants significantly increased in base portion (<xref ref-type="fig" rid="idm1842517172">Figure 2</xref>h) of SR cuttings, compared to NR cuttings 77 days after planting.  TBARS, total phenols, and antioxidants content were not changed in stem portion and needles of two types of cuttings 77 days after planting.</p>
        <fig id="idm1842517172">
          <label>Figure 2.</label>
          <caption>
            <title> TBARS, total phenols, and antioxidants content of shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. TBARS (Figs. 2a, 2b, and 2c), total phenols (Figs. 2d, 2e, and 2f), and antioxidants content (Figs. 2g, 2h, and 2i) was measured from samples of stem portion, basal portion, and needles of rooted cuttings. Experiment was repeated five times. The statistically significant difference between groups was determined by one-way ANOVA. Data are presented as means of five independent experiments. Error bars represent standard error. The asterisk indicates significant differences compared to the Phase I, as assessed by a t-test. *P&lt;0.05, **P&lt;0.01, ***P&lt;0.001, significant relative to rooted cuttings with low rate of root formation. N.S., no statistics significance. Vertical bars indicate standard error.</title>
          </caption>
          <graphic xlink:href="images/image2.jpeg" mime-subtype="jpeg"><alt-text>Figure 2. TBARS, total phenols, and antioxidants content of shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting.</alt-text></graphic>
        </fig>
      </sec>
      <sec id="idm1841565116">
        <title>PPO, CAT, and POD Activity in Cuttings </title>
        <p>To examine the effect of PPO, CAT, and POD activity on root formation, PPO, CAT, and POD activity in shoot cuttings of T. chinensis                                        var. mairei were measured at 0 and 77 days after planting. PPO (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>a, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>d, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>g, and <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>j),             CAT (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>b,<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>e,<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>h, and <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>k), and POD activity                   (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>c,<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>f, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>i, and <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>l) were examined in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that activity of PPO, CAT, and POD was not changed in stem portion of cuttings between normal rooting and super rooting cuttings (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>a, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>b, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>c). However, activity of PPO, CAT, and POD was significantly higher in basal portion (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>d, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>e, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>f) and adventitious roots (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>j, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>k,<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>l) of SR cuttings, compared to NR cuttings 77 days after planting.  Activity of PPO and CAT in needles of SR cuttings is similar to that of NR cuttings 77 days after planting (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>g, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>h). Activity of POD significantly increased in needles (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>i) of SR cuttings, compared to NR cuttings 77 days after planting.  </p>
        <fig id="idm1842540284">
          <label>Figure 3.</label>
          <caption>
            <title> PPO, CAT, and POD activity in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. PPO (Figs. 3a, 3d, 3g, and 3j), CAT (Figs. 3b, 3e, 3h, and 3k), and POD activity (Figs. 3c, 3f, 3i, and 3l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Experiment was repeated five times. The statistically significant difference between groups was determined by one-way ANOVA. Data are presented as means of five independent experiments. Error bars represent standard error. The asterisk indicates significant differences compared to the rooted cuttings with low rate of root formation, as assessed by a t-test. *P&lt;0.05, **P&lt;0.01, ***P&lt;0.001, significant relative to Phase I. N.S., no statistics significance. Vertical bars indicate standard error.</title>
          </caption>
          <graphic xlink:href="images/image3.jpeg" mime-subtype="jpeg"><alt-text>Figure 3. PPO, CAT, and POD activity in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting.</alt-text></graphic>
        </fig>
      </sec>
      <sec id="idm1841526540">
        <title>APOX, GR, and SOD Activity in Cuttings</title>
        <p>To examine the effect of APOX, GR, and SOD activity on root formation, APOX, GR, and SOD activity were measured in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting.                     APOX (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>a,<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>d,<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>g, and <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>j), GR (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>b, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>e, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>h, and <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>k), and SOD activity (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>c, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>f, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>i, and <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that activity of APOX, GR, and SOD in stem portion (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>a, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>b, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>c) and needles (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>g, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>h, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>i) of SR cuttings were similar to that of NR cuttings. However, activity of APOX, GR, and SOD in adventitious roots was significantly higher in SR cuttings (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>j, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>k, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>l), compared to NR cuttings 77 days after planting. Activity of APOX, GR, and SOD in basal portion (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>d, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>e, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>f) of NR cuttings was higher than SR cuttings before planting (0 day). Activity of APOX, GR, and SOD in basal portion (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>d, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>e, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>f) of NR cuttings with was similar to that of SR cuttings 77 days after planting.</p>
        <fig id="idm1842471980">
          <label>Figure 4.</label>
          <caption>
            <title> APOX, GR, and SOD activity in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. APOX (Figs. 4a, 4d, 4g, and 4j), GR (Figs. 4b, 4e, 4h, and 4k), and SOD activity (Figs. 4c, 4f, 4i, and 4l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Experiment was repeated five times. The statistically significant difference between groups was determined by one-way ANOVA. Data are presented as means of five independent experiments. Error bars represent standard error. The asterisk indicates significant differences compared to the rooted cuttings with low rate of root formation, as assessed by a t-test. *P&lt;0.05, **P&lt;0.01, ***P&lt;0.001, significant relative to Phase I. N.S., no statistics significance.</title>
          </caption>
          <graphic xlink:href="images/image4.jpeg" mime-subtype="jpeg"><alt-text>Figure 4. APOX, GR, and SOD activity in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting.</alt-text></graphic>
        </fig>
      </sec>
      <sec id="idm1841512644">
        <title>Expression of microRNAs in Cuttings</title>
        <p>To examine the effect of expression of microRNAs on root formation, expression of microRNAs were measured in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting. MicroRNA162 (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>a, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>d, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>g, and <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>j), miR408 (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>b, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>e, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>h, and <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>k), and miR857 (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>c, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>f, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>i, and <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of T. chinensis var. mairei at 0 and 77 days after planting. Our results demonstrated that expression of miR162, miR408, and miR857 was not changed in stem portion (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>a, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>b,<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>c) of SR cuttings, compared to NR cuttings. However, expression of miR162, miR408, and miR857 significantly increased in basal portion (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>d, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>e, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>f) of SR cuttings, compared to NR cuttings. Expression of miR162 was not changed in needles (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>g) and roots (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>j), but expression of miR857 significantly increased in needles (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>i) and roots (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>l) of SR cuttings, compared to NR cuttings 77 days after planting. Expression of miR408 was not changed in roots (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>k), but significantly increased in needle (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>h) of SR cuttings, compared to NR cuttings 77 days after planting.</p>
        <fig id="idm1842462476">
          <label>Figure 5.</label>
          <caption>
            <title> Expression of microRNAs in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after  planting. MicroRNA162 (Figs. 5a, 5d, 5g, and 5j), miR408 (Figs. 5b, 5e, 5h, and 5k), and miR857 (Figs. 5c, 5f, 5i, and 5l) in stem portion, basal portion, needles, and adventitious roots of rooted cuttings of                       T. chinensis var. mairei at 0 and 77 days after planting. Experiment was repeated five times. The               statistically significant difference between groups was determined by one-way ANOVA. Data are presented as means of five independent experiments. Error bars represent standard error. The asterisk indicates                       significant differences compared to the rooted cuttings with low rate of root formation, as assessed by a t-test. *P&lt;0.05, **P&lt;0.01, ***P&lt;0.001, significant relative to Phase I. N.S., no statistics significance.</title>
          </caption>
          <graphic xlink:href="images/image5.jpeg" mime-subtype="jpeg"><alt-text>Figure 5. Expression of microRNAs in shoot cuttings of T. chinensis var. mairei at 0 and 77 days after planting.</alt-text></graphic>
        </fig>
      </sec>
    </sec>
    <sec id="idm1841533812" sec-type="discussion">
      <title>Discussion</title>
      <p>Environmental conditions and endogenous biochemical compounds are important in regulating adventitious root formation. For example, the endogenous factor IAA regulates mitotic activity for root initiation in the cuttings of grape <xref ref-type="bibr" rid="ridm1850444548">49</xref>,<xref ref-type="bibr" rid="ridm1850343420">72</xref>,<xref ref-type="bibr" rid="ridm1850339316">73</xref>,<xref ref-type="bibr" rid="ridm1850319940">77</xref>. The IAA level in grape cuttings at planting is higher in easy-to-root varieties than in difficult-to-root                 varieties <xref ref-type="bibr" rid="ridm1850317996">78</xref>,<xref ref-type="bibr" rid="ridm1850315836">79</xref>,<xref ref-type="bibr" rid="ridm1850313100">80</xref>. Increased IAA level of cuttings during planting is a more important factor for rooting than the higher IAA level at planting <xref ref-type="bibr" rid="ridm1850620388">8</xref>. High level of IAA was observed in the cuttings of chestnut with high rooting ability in the period of four days after                   planting <xref ref-type="bibr" rid="ridm1850307628">81</xref>, suggesting that accumulated IAA in basal portion of cuttings may regulate root architecture during rooting. Reduction of auxin signaling by the auxin antagonist α-(phenyl ethyl-2-one)-IAA rapidly decreases the expression of several core cell cycle genes <xref ref-type="bibr" rid="ridm1850306404">82</xref>,<xref ref-type="bibr" rid="ridm1850304028">83</xref>. Overexpression of the mitotic cyclin CYCA2;3, which inhibits endocycle onset, promotes the termination of endoreplication <xref ref-type="bibr" rid="ridm1850300212">84</xref>. IAA signaling is critical for determining the timing of the transition to the      endocycle <xref ref-type="bibr" rid="ridm1850620388">8</xref>,<xref ref-type="bibr" rid="ridm1850593452">12</xref>,<xref ref-type="bibr" rid="ridm1850589636">13</xref>,<xref ref-type="bibr" rid="ridm1850306404">82</xref>. IAA plays a crucial role in stem cell specification in roots <xref ref-type="bibr" rid="ridm1850304028">83</xref>,<xref ref-type="bibr" rid="ridm1850300212">84</xref>,<xref ref-type="bibr" rid="ridm1850294164">85</xref>. In addition, reduction in RETINOBLASTOMA-RELATED protein (RBR) expression in Arabidopsis roots increases the number of stem cells without changing the duration of cell cycles in the meristem <xref ref-type="bibr" rid="ridm1850292508">86</xref>,<xref ref-type="bibr" rid="ridm1850288620">87</xref>. Overexpression of RBR results in a loss of stem cells, indicating that an appropriate level of RBR is essential for maintaining the appropriate number of stem cells <xref ref-type="bibr" rid="ridm1850292508">86</xref>,<xref ref-type="bibr" rid="ridm1850288620">87</xref> indicating that the amount of IAA in basal portion of cuttings may affect rooting ability. Polyamines are another important endogenous factor in the maintenance of rooting ability in plants <xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850352924">69</xref>,<xref ref-type="bibr" rid="ridm1850351556">70</xref>,<xref ref-type="bibr" rid="ridm1850322388">76</xref>,<xref ref-type="bibr" rid="ridm1850285812">88</xref>,<xref ref-type="bibr" rid="ridm1850281564">89</xref>. It has been reported that an increase in free Put could be correlated with the formation of root primordial in cuttings           of grape <xref ref-type="bibr" rid="ridm1850339316">73</xref>,<xref ref-type="bibr" rid="ridm1850317996">78</xref>, and that Put may be a good marker for root differentiation <xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>. An increase in free Put levels was observed at an early stage of rooting of cuttings <xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>. Concentrations of Spd may affect root formation after planting in woody plants. It has been reported that the high level of Spd can be an indicator of the rooting ability of these                           species   <xref ref-type="bibr" rid="ridm1850546764">25</xref>,<xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>. Conjugated Put and Spd may have an effect on rooting. Conjugated Put and Spd were found to accumulate in Chrysanthemum leaf explants on a medium promoting root formation, followed by a decrease during the period of root                            emergence <xref ref-type="bibr" rid="ridm1850546764">25</xref>,<xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>. In addition, changes in the levels were more rapid and substantial in the conjugated Put and Spd than in the free Put and Spd <xref ref-type="bibr" rid="ridm1850546764">25</xref>,<xref ref-type="bibr" rid="ridm1850541868">26</xref>,<xref ref-type="bibr" rid="ridm1850527236">27</xref>. Considering effects of auxin and polyamines on root formation have been extensively investigated in plants, we focus on influence of antioxidative enzymes and microRNAs on root formation in T. chinensis cuttings.</p>
      <p>The rooting ability of T. chinensis cuttings depends on the varieties and cultivars. So far, little information on the rooting ability of T. chinensis cuttings is available. To analyze the effects of the endogenous factors on root formation in T. chinensis cuttings, we measured the levels of antioxidative enzymes and microRNAs in the stem portion, needles, roots, and basal portion of cuttings during the process of adventitious rooting in two cultivars of this species, known to have different adventitious rooting patterns. Our results demonstrated that antioxidative enzymes and microRNAs in the basal portion of the cuttings with high rate of root formation is an important factor affecting root formation in cuttings of T. chinensis. It has been reported in cuttings of some woody plants that formation of adventitious roots requires a                        certain level of antioxidative enzyme sand                                  microRNAs <xref ref-type="bibr" rid="ridm1850522916">29</xref>,<xref ref-type="bibr" rid="ridm1850533788">31</xref>,<xref ref-type="bibr" rid="ridm1850509556">32</xref>,<xref ref-type="bibr" rid="ridm1850507180">33</xref>,<xref ref-type="bibr" rid="ridm1850502428">34</xref>,<xref ref-type="bibr" rid="ridm1850628844">5</xref><xref ref-type="bibr" rid="ridm1850761900">1</xref>. The activity of different anti-oxidative enzymes like glutathione reductase (GR), superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APO), peroxidase (POD) and polyphenol oxidase (PPO) were examined in cultivars of tea <xref ref-type="bibr" rid="ridm1850509556">32</xref> and wheat <xref ref-type="bibr" rid="ridm1850522916">29</xref>. These enzymes were reported to affect seed germination and root growth of several plant species including soybean roots <xref ref-type="bibr" rid="ridm1850507180">33</xref>. In the present study, we identified that activity of PPO, CAT, and POD was significantly increased in basal portion (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>d, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>e, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>f) and adventitious roots (<xref ref-type="fig" rid="idm1842540284">Figure 3</xref>j, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>k, <xref ref-type="fig" rid="idm1842540284">Figure 3</xref>l) of rooted SR cuttings, compared to NR cuttings 77 days after planting.</p>
      <p>To counteract the effects of environmental stresses, the plants use antioxidant detoxification to avoid the accumulation of damaging free oxygen radicals and changes in the antioxidative machinery in plants under stress conditions played important role in root formation <xref ref-type="bibr" rid="ridm1850486876">39</xref>,<xref ref-type="bibr" rid="ridm1850483852">40</xref>,<xref ref-type="bibr" rid="ridm1850514668">41</xref>,<xref ref-type="bibr" rid="ridm1850512292">42</xref>,<xref ref-type="bibr" rid="ridm1850463772">43</xref>,<xref ref-type="bibr" rid="ridm1850461972">44</xref>. POD, APX, GR, and lipid peroxidation are directly interrelated with different factors to modulate activities of various stress                  markers <xref ref-type="bibr" rid="ridm1850486876">39</xref>. The activities of antioxidative enzymes (SOD, CAT, POD, GR, APOX, MDHAR and DHAR) and contents of proteins and glutathione were increased in leaves of B. juncea plants after stress treatment <xref ref-type="bibr" rid="ridm1850514668">41</xref>. SOD, APOX, GR accumulated in plants at comparably higher levels than their counterparts under dry soil conditions in peanut <xref ref-type="bibr" rid="ridm1850512292">42</xref>. Inhibition of CAT, SOD, GPOX, APOX, GR, as well as increasing MDA concentration results in decreasing of fine roots volume <xref ref-type="bibr" rid="ridm1850463772">43</xref>. In the present study, we identified that activity of APOX, GR, and SOD in adventitious roots significantly increased in SR cuttings (<xref ref-type="fig" rid="idm1842471980">Figure 4</xref>j, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>k, <xref ref-type="fig" rid="idm1842471980">Figure 4</xref>l), compared to NR cuttings 77 days after planting.</p>
      <p>MicroRNAs are known to affect root formation in plants. In Chlamydomonas reinhardtii, expression of multiple microRNAs, miR397, miR408, and miR857, involved in copper homeostasis <xref ref-type="bibr" rid="ridm1850465716">53</xref>,<xref ref-type="bibr" rid="ridm1850407396">54</xref>,<xref ref-type="bibr" rid="ridm1850405380">55</xref>. In I. campanulata, miR398, miR168, miR858, miR162 and miR408 were up-regulated, while miR394 and miR171 were down-regulated under stress. In J. pentantha, miR394, miR156, miR160, miR164, miR167,                    miR172, miR319, miR395, miR396, miR403 were                  up-regulated and miR157 was down-regulated under                            stress. Basal miRNA levels and their drought-mediated regulation were very different between the two                  species <xref ref-type="bibr" rid="ridm1850396596">58</xref>,<xref ref-type="bibr" rid="ridm1850387452">60</xref>,<xref ref-type="bibr" rid="ridm1850384284">61</xref>. Plants utilize complex gene regulation mechanisms to tolerate abiotic stresses. MicroRNAs are important regulators of gene expression acting at   post-transcriptional level. Expression levels of miR408 regulated drought responsive genes and rooting-related genes [90-94]. Expression of microRNAs is related to the nutrition. Upon N starvation, the expression of miR169, miR171, miR395, miR397, miR398, miR399, miR408, miR827, and miR857 was repressed, whereas those of miR160, miR780, miR826, miR842, and miR846 were induced. Among these N-starvation-responsive miRNAs, several were involved in cross-talk among responses to different nutrient (N, P, S, Cu) deficiencies. miR160, miR167, and miR171 could be responsible for the development of                         Arabidopsis root systems under N-starvation                  conditions <xref ref-type="bibr" rid="ridm1850465716">53</xref>,<xref ref-type="bibr" rid="ridm1850407396">54</xref>,<xref ref-type="bibr" rid="ridm1850405380">55</xref>,<xref ref-type="bibr" rid="ridm1850377588">63</xref>,<xref ref-type="bibr" rid="ridm1850366100">64</xref>. In the present study, we identified that expression of miR162, miR408, and miR857 significantly increased in basal portion   (<xref ref-type="fig" rid="idm1842462476">Figure 5</xref>d, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>e, <xref ref-type="fig" rid="idm1842462476">Figure 5</xref>f) of SR cuttings, compared to NR cuttings.  </p>
    </sec>
    <sec id="idm1841442236" sec-type="conclusions">
      <title>Conclusion</title>
      <p>In the present study, changes in the levels of antioxidative enzymes and microRNAs during the process of rooting were observed in the cuttings of T. chinensis. Significant increase in antioxidative enzymes and microRNAs expression levels was found in basal portion, stem portion, tips of adventitious roots, and tips of lateral roots in SR cuttings 77 days after planting in T. chinensis. Compared to NR cuttings, SR cuttings had higher expression of polyphenoloxidase (PPO), catalase  (CAT), peroxidase (POD), ascorbate peroxidase (APOX), glutathione reductase (GR), and superoxide dismutase (SOD) in the adventitious roots and basal portion of the rooted cuttings 77 days after planting.  In the basal portion of cuttings, the content of thiobarbituric acid reactive substances (TBARS) and total phenols were decreased and the content of antioxidants was increased, but they did not change in the needles of cuttings during planting. Analysis of microRNAs by quantitative realtime PCR demonstrated that expression of miR162, miR408, and miR857 increases in the basal portion of cuttings, but not in the stem portion of cuttings, 77 days after planting. Expression of miR408 and miR857 were also increased in the needles of cuttings 77 days after planting. Changes of these antioxidative enzymes and microRNAs are associated with the rooting features of T. chinensis var. mairei cuttings. Our research revealed that the levels and changes in endogenous factors affecting the rooting of cuttings differ between easy-to-root and                    recalcitrant-to-root T. chinensis. The individual features of antioxidative enzymes and microRNAs would benefit the development of efficient propagation methods for cuttings of T. chinensis.</p>
    </sec>
  </body>
  <back>
    <ack>
      <p>We are grateful to the university research instrumentation facility for providing necessary experiment set up. The authors are grateful to Dr. W. Thompson, Dr. P. Bradshaw, and Dr. M. Page for their critical reading and suggestions during the preparation of this manuscript. This work was supported by a grant from the National Natural Science Foundation of China (31270740).</p>
    </ack>
    <ref-list>
      <ref id="ridm1850761900">
        <label>1.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>E Stevens</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>E Woeste</given-names>
          </name>
          <name>
            <surname>Pijut</surname>
            <given-names>P M</given-names>
          </name>
          <article-title>Localized gene expression changes during adventitious root formation in black walnut (Juglans nigra L.), doi: 10.1093/treephys/tpx175. Tree physiology</article-title>
          <date>
            <year>2018</year>
          </date>
          <pub-id pub-id-type="doi">10.1093/treephys/tpx175</pub-id>
        </mixed-citation>
      </ref>
      <ref id="ridm1850766364">
        <label>2.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Herrmann</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Recht</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Boenn</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Feldhahn</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Angay</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Fleischmann</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>T Tarkka</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>E Grams</given-names>
          </name>
          <name>
            <surname>Buscot</surname>
            <given-names>F</given-names>
          </name>
          <article-title>Endogenous rhythmic growth in oak trees is regulated by internal clocks rather than resource availability</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Journal of experimental botany</source>
          <volume>66</volume>
          <fpage>7113</fpage>
          <lpage>7127</lpage>
        <pub-id pub-id-type="doi">10.1093/jxb/erv408</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850776676">
        <label>3.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Abu-Abied</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Szwerdszarf</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Mordehaev</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Yaniv</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Levinkron</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Rubinstein</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Riov</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Ophir</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Sadot</surname>
            <given-names>E</given-names>
          </name>
          <article-title>Gene expression profiling in juvenile and mature cuttings of Eucalyptus grandis reveals the importance of microtubule remodeling during adventitious root formation</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>BMC genomics</source>
          <volume>15</volume>
          <fpage>826</fpage>
        <pub-id pub-id-type="doi">10.1186/1471-2164-15-826</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850839044">
        <label>4.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>B</surname>
            <given-names>E Llorente</given-names>
          </name>
          <name>
            <surname>Larraburu</surname>
            <given-names>E E</given-names>
          </name>
          <article-title>In vitro propagation of fraser photinia using Azospirillum-mediated root development, Methods in molecular biology, 11013,245-258</article-title>
          <date>
            <year>2013</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1850628844">
        <label>5.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Zhang</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Sun</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>I</surname>
            <given-names>W Wilson</given-names>
          </name>
          <name>
            <surname>Wu</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Hoffman</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Cheng</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Qiu</surname>
            <given-names>D</given-names>
          </name>
          <article-title>Baseline survey of root-associated microbes of Taxus chinensis (Pilger) Rehd</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>PloS one</source>
          <volume>10</volume>
          <fpage>0123026</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0123026</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850625748">
        <label>6.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Syklowska-Baranek</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Pietrosiuk</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Kokoszka</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Furmanowa</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Enhancement of taxane production in hairy root culture of Taxus x media var</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>Hicksii, Journal of plant physiology</source>
          <volume>166</volume>
          <fpage>1950</fpage>
          <lpage>1954</lpage>
        <pub-id pub-id-type="doi">10.1016/j.jplph.2009.05.001</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850631076">
        <label>7.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Skorupinska-Tudek</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Pytelewska</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Zelman-Femiak</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Mikoszewski</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Olszowska</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Gajdzis-Kuls</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Urbanska</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Syklowska-Baranek</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Hertel</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Chojnacki</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Swiezewska</surname>
            <given-names>E</given-names>
          </name>
          <article-title>In vitro plant tissue cultures accumulate polyisoprenoid alcohols</article-title>
          <date>
            <year>2007</year>
          </date>
          <source>Acta biochimica Polonica</source>
          <volume>54</volume>
          <fpage>847</fpage>
          <lpage>852</lpage>
        <pub-id pub-id-type="doi">10.18388/abp.2007_3184</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850620388">
        <label>8.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Fattorini</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Veloccia</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>Della Rovere</given-names>
          </name>
          <name>
            <surname>D’Angeli</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Falasca</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names/>
          </name>
          <article-title>Indole-3-butyric acid promotes adventitious rooting in Arabidopsis thaliana thin cell layers by conversion into indole-3-acetic acid and stimulation of anthranilate synthase activity</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>BMC plant biology</source>
          <volume>17</volume>
          <fpage>121</fpage>
        <pub-id pub-id-type="doi">10.1186/s12870-017-1071-x</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850615348">
        <label>9.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Yan</surname>
            <given-names>Y H</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>L Li</given-names>
          </name>
          <name>
            <surname>X</surname>
            <given-names>Q Zhang</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>Y Yang</given-names>
          </name>
          <name>
            <surname>Wan</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names>M Ma</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names>Q Zhu</given-names>
          </name>
          <name>
            <surname>Peng</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>K Huang</given-names>
          </name>
          <article-title>Effect of naphthalene acetic acid on adventitious root development and associated physiological changes in stem cutting of Hemarthria compressa</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>PloS one</source>
          <volume>9</volume>
          <fpage>90700</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0090700</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850607148">
        <label>10.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Katayama</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Masui</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kageyama</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Kawabata</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Kanayama</surname>
            <given-names>K</given-names>
          </name>
          <article-title>Synthesis and biological activities of 4-trifluoromethylindole-3-acetic acid: a new fluorinated indole auxin</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>Bioscience, biotechnology, and biochemistry</source>
          <volume>72</volume>
          <fpage>2025</fpage>
          <lpage>2033</lpage>
        <pub-id pub-id-type="doi">10.1271/bbb.80138</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850612620">
        <label>11.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>G</surname>
            <given-names>C Pagnussat</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>L Lanteri</given-names>
          </name>
          <name>
            <surname>Lamattina</surname>
            <given-names>L</given-names>
          </name>
          <article-title>Nitric oxide and cyclic GMP are messengers in the indole acetic acid-induced adventitious rooting process, Plant physiology</article-title>
          <date>
            <year>2003</year>
          </date>
          <volume>132</volume>
          <fpage>1241</fpage>
          <lpage>1248</lpage>
        <pub-id pub-id-type="doi">10.1104/pp.103.022228</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850593452">
        <label>12.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>C</surname>
            <given-names>L Ribeiro</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>M Silva</given-names>
          </name>
          <name>
            <surname>Drost</surname>
            <given-names>D R</given-names>
          </name>
          <name>
            <surname>Novaes</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>R Novaes</given-names>
          </name>
          <name>
            <surname>Dervinis</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Kirst</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Integration of genetic, genomic and transcriptomic information identifies putative regulators of adventitious root formation in Populus</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>BMC plant biology</source>
          <volume>16</volume>
          <fpage>66</fpage>
        <pub-id pub-id-type="doi">10.1186/s12870-016-0753-0</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850589636">
        <label>13.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>T</surname>
            <given-names>D Salla</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>da Silva</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>V Astarita</given-names>
          </name>
          <name>
            <surname>E</surname>
            <given-names>R Santarem</given-names>
          </name>
          <article-title>Streptomyces rhizobacteria modulate the secondary metabolism of Eucalyptus plants, Plant physiology and biochemistry :</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>PPB</source>
          <volume>85</volume>
          <fpage>14</fpage>
          <lpage>20</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2014.10.008</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850586252">
        <label>14.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>B</surname>
            <given-names>E Sample</given-names>
          </name>
          <name>
            <surname>Lowe</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Seeley</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Markin</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>McCarthy</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Hansen</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Depth of the biologically active zone in upland habitats at the Hanford Site, Washington: Implications for remediation and ecological risk management, Integrated environmental assessment and management</article-title>
          <date>
            <year>2015</year>
          </date>
          <volume>11</volume>
          <fpage>150</fpage>
          <lpage>160</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850598924">
        <label>15.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Veld</surname>
            <given-names>WA Man In 't</given-names>
          </name>
          <name>
            <surname>Rosendahl</surname>
            <given-names>K C</given-names>
          </name>
          <name>
            <surname>PC</surname>
            <given-names>van Rijswick</given-names>
          </name>
          <name>
            <surname>Meffert</surname>
            <given-names>J P</given-names>
          </name>
          <name>
            <surname>Westenberg</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Vossenberg</surname>
            <given-names>BT van de</given-names>
          </name>
          <name>
            <surname>Denton</surname>
            <given-names>G</given-names>
          </name>
          <article-title>FA van Kuik (2015) Phytophthora terminalis sp. nov. and Phytophthora occultans sp. nov., two invasive pathogens of ornamental plants in Europe</article-title>
          <fpage>107</fpage>
          <lpage>54</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850596764">
        <label>16.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>T</surname>
            <given-names>Y Dou</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>W Luan</given-names>
          </name>
          <name>
            <surname>X</surname>
            <given-names>B Liu</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>Y Li</given-names>
          </name>
          <name>
            <surname>X</surname>
            <given-names>F Du</given-names>
          </name>
          <name>
            <surname>Yang</surname>
            <given-names>L</given-names>
          </name>
          <article-title>Enzymatic hydrolysis of 7-xylosyltaxanes by an extracellular xylosidase from Cellulosimicrobium cellulans</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Biotechnology letters</source>
          <volume>37</volume>
          <fpage>1905</fpage>
          <lpage>1910</lpage>
        <pub-id pub-id-type="doi">10.1007/s10529-015-1867-4</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850575316">
        <label>17.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mazzio</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Badisa</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Mack</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Deiab</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>F Soliman</given-names>
          </name>
          <article-title>High throughput screening of natural products for anti-mitotic effects in MDA-MB-231 human breast carcinoma cells</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>Phytotherapy research : PTR</source>
          <volume>28</volume>
          <fpage>856</fpage>
          <lpage>867</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850572580">
        <label>18.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Jimenez</surname>
            <given-names>J T</given-names>
          </name>
          <name>
            <surname>Sturdikova</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Brezova</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Svajdlenka</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Novotova</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Screening of mutant strain Streptomyces mediolani sp. AC37 for (-)-8-O-methyltetrangomycin production enhancement</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>Journal of microbiology</source>
          <volume>50</volume>
          <fpage>1014</fpage>
          <lpage>1023</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850570780">
        <label>19.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Brunakova</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Kosuth</surname>
            <given-names>J</given-names>
          </name>
          <article-title>Gene expression profiling in Taxus baccata L. seedlings and cell cultures, Methods in molecular biology</article-title>
          <date>
            <year>2009</year>
          </date>
          <volume>547</volume>
          <fpage>249</fpage>
          <lpage>262</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850568764">
        <label>20.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Onrubia</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Pollier</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>Vanden Bossche</given-names>
          </name>
          <name>
            <surname>Goethals</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Gevaert</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Moyano</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Vidal-Limon</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>M Cusido</given-names>
          </name>
          <name>
            <surname>Palazon</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Goossens</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Taximin, a conserved plant-specific peptide is involved in the modulation of plant-specialized metabolism</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>Plant biotechnology journal</source>
          <volume>12</volume>
          <fpage>971</fpage>
          <lpage>983</lpage>
        <pub-id pub-id-type="doi">10.1111/pbi.12205</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850563436">
        <label>21.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Rosangkima</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>B Prasad</given-names>
          </name>
          <article-title>Antitumour activity of some plants from Meghalaya and Mizoram against murine ascites Dalton's lymphoma, Indian journal of experimental biology</article-title>
          <date>
            <year>2004</year>
          </date>
          <volume>42</volume>
          <fpage>981</fpage>
          <lpage>988</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850560124">
        <label>22.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Li</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Yang</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Zhou</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Zhao</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Jian</surname>
            <given-names>Z</given-names>
          </name>
          <article-title>Isolation and identification of a 10-deacetyl baccatin-III-producing endophyte from Taxus wallichiana, Applied biochemistry and biotechnology</article-title>
          <date>
            <year>2015</year>
          </date>
          <volume>175</volume>
          <fpage>2224</fpage>
          <lpage>2231</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850554540">
        <label>23.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>C</surname>
            <given-names>Hao da</given-names>
          </name>
          <name>
            <surname>Ge</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Xiao</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Yang</surname>
            <given-names>L</given-names>
          </name>
          <article-title>The first insight into the tissue specific taxus transcriptome via Illumina second generation sequencing</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>PloS one</source>
          <volume>6</volume>
          <fpage>21220</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0021220</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850549284">
        <label>24.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Quan</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Meng</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Zhao</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Xu</surname>
            <given-names>X</given-names>
          </name>
          <article-title>Molecular cloning, characterization and expression analysis of the SAMS gene during adventitious root development in IBA-induced tetraploid black locust</article-title>
          <date>
            <year>2014</year>
          </date>
          <source>PloS one</source>
          <volume>9</volume>
          <fpage>108709</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0108709</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850546764">
        <label>25.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>A</surname>
            <given-names>I Sannazzaro</given-names>
          </name>
          <name>
            <surname>Echeverria</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>E</surname>
            <given-names>O Alberto</given-names>
          </name>
          <name>
            <surname>O</surname>
            <given-names>A Ruiz</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>B Menendez</given-names>
          </name>
          <article-title>Modulation of polyamine balance in Lotus glaber by salinity and arbuscular mycorrhiza, Plant physiology and biochemistry :</article-title>
          <date>
            <year>2007</year>
          </date>
          <source>PPB</source>
          <volume>45</volume>
          <fpage>39</fpage>
          <lpage>46</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2006.12.008</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850541868">
        <label>26.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Niemi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Haggman</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Sarjala</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Effects of exogenous diamines on the interaction between ectomycorrhizal fungi and adventitious root formation in Scots pine in vitro</article-title>
          <date>
            <year>2002</year>
          </date>
          <source>Tree physiology</source>
          <volume>22</volume>
          <fpage>373</fpage>
          <lpage>381</lpage>
        <pub-id pub-id-type="doi">10.1093/treephys/22.6.373</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850527236">
        <label>27.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tonon</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Kevers</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Gaspar</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Changes in polyamines, auxins and peroxidase activity during in vitro rooting of Fraxinus angustifolia shoots: an auxin-independent rooting model, Tree physiology</article-title>
          <date>
            <year>2001</year>
          </date>
          <volume>21</volume>
          <fpage>655</fpage>
          <lpage>663</lpage>
        <pub-id pub-id-type="doi">10.1093/treephys/21.10.655</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850525652">
        <label>28.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Basiglini</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Pintore</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Forni</surname>
            <given-names>C</given-names>
          </name>
          <article-title>Effects of treated industrial wastewaters and temperatures on growth and enzymatic activities of duckweed (Lemna minor L.), Ecotoxicology and environmental safety, 153;54-59</article-title>
          <date>
            <year>2018</year>
          </date>
        <pub-id pub-id-type="doi">10.1016/j.ecoenv.2018.01.053</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850522916">
        <label>29.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Spanic</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>Viljevac Vuletic</given-names>
          </name>
          <name>
            <surname>Abicic</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Marcek</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Early response of wheat antioxidant system with special reference to Fusarium head blight stress, Plant physiology and biochemistry : PPB</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>115</volume>
          <fpage>34</fpage>
          <lpage>43</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2017.03.010</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850519964">
        <label>30.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Iqbal</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Wu</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Tang</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Zhu</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Li</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Physiological and transcriptome analysis of heteromorphic leaves and hydrophilic roots in response to soil drying in desert Populus euphratica</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>Scientific reports</source>
          <volume>7</volume>
          <fpage>12188</fpage>
        <pub-id pub-id-type="doi">10.1038/s41598-017-12091-2</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850533788">
        <label>31.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>JJ</surname>
            <given-names>Dragisic Maksimovic</given-names>
          </name>
          <name>
            <surname>Poledica</surname>
            <given-names>M M</given-names>
          </name>
          <name>
            <surname>Radivojevic</surname>
            <given-names>D D</given-names>
          </name>
          <name>
            <surname>Milivojevic</surname>
            <given-names>J M</given-names>
          </name>
          <article-title>Enzymatic Profile of 'Willamette' Raspberry Leaf and Fruit Affected by Prohexadione-Ca and Young Canes Removal Treatments</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>Journal of agricultural and food chemistry</source>
          <volume>65</volume>
          <fpage>5034</fpage>
          <lpage>5040</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850509556">
        <label>32.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Palanisamy</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>K Mandal</given-names>
          </name>
          <article-title>Susceptibility against grey blight disease-causing fungus Pestalotiopsis sp. in tea (Camellia sinensis (L.) O. Kuntze) cultivars is influenced by anti-oxidative enzymes, Applied biochemistry and biotechnology</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>172</volume>
          <fpage>216</fpage>
          <lpage>223</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850507180">
        <label>33.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>A</surname>
            <given-names>R Soares</given-names>
          </name>
          <name>
            <surname>Ferrarese</surname>
            <given-names>M de Lourdes Lucio</given-names>
          </name>
          <name>
            <surname>Siqueira-Soares</surname>
            <given-names>R de Cassia</given-names>
          </name>
          <name>
            <surname>Marchiosi</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Finger-Teixeira</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Ferrarese-Filho</surname>
            <given-names>O</given-names>
          </name>
          <article-title>The allelochemical L-DOPA increases melanin production and reduces reactive oxygen species in soybean roots</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>Journal of chemical ecology</source>
          <volume>37</volume>
          <fpage>891</fpage>
          <lpage>898</lpage>
        <pub-id pub-id-type="doi">10.1007/s10886-011-9988-2</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850502428">
        <label>34.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Montavon</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Kukic</surname>
            <given-names>K R</given-names>
          </name>
          <name>
            <surname>Bortlik</surname>
            <given-names>K</given-names>
          </name>
          <article-title>A simple method to measure effective catalase activities: optimization, validation, and application in green coffee</article-title>
          <date>
            <year>2007</year>
          </date>
          <source>Analytical biochemistry</source>
          <volume>360</volume>
          <fpage>207</fpage>
          <lpage>215</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ab.2006.10.035</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850501780">
        <label>35.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bosselut</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>Van Ghelder</given-names>
          </name>
          <name>
            <surname>Claverie</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Voisin</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>P Onesto</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>N Rosso</given-names>
          </name>
          <name>
            <surname>Esmenjaud</surname>
            <given-names>D</given-names>
          </name>
          <article-title>Agrobacterium rhizogenes-mediated transformation of Prunus as an alternative for gene functional analysis in hairy-roots and composite plants, Plant cell reports</article-title>
          <date>
            <year>2011</year>
          </date>
          <volume>30</volume>
          <fpage>1313</fpage>
          <lpage>1326</lpage>
        <pub-id pub-id-type="doi">10.1007/s00299-011-1043-9</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850496596">
        <label>36.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Trobec</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Stampar</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Veberic</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Osterc</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Fluctuations of different endogenous phenolic compounds and cinnamic acid in the first days of the rooting process of cherry rootstock 'GiSelA 5' leafy cuttings</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Journal of plant physiology</source>
          <volume>162</volume>
          <fpage>589</fpage>
          <lpage>597</lpage>
        <pub-id pub-id-type="doi">10.1016/j.jplph.2004.10.009</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850495084">
        <label>37.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Esmenjaud</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Minot</surname>
            <given-names>J C</given-names>
          </name>
          <name>
            <surname>Voisin</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Salesses</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Bonnet</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Effect of Cutting Age on the Resistance of Prunus cerasifera (Myrobalan Plum) to Meloidogyne arenaria</article-title>
          <date>
            <year>1995</year>
          </date>
          <source>Journal of nematology</source>
          <volume>27</volume>
          <fpage>634</fpage>
          <lpage>638</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850489900">
        <label>38.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Wilkins</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>JJ</surname>
            <given-names>Van Oosten</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>T Besford</given-names>
          </name>
          <article-title>Effects of elevated CO(2) on growth and chloroplast proteins in Prunus avium</article-title>
          <date>
            <year>1994</year>
          </date>
          <source>Tree physiology</source>
          <volume>14</volume>
          <fpage>769</fpage>
          <lpage>779</lpage>
        <pub-id pub-id-type="doi">10.1093/treephys/14.7-8-9.769</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850486876">
        <label>39.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>M</surname>
            <given-names>K Kanwar</given-names>
          </name>
          <name>
            <surname>Poonam</surname>
            <given-names>S Pal</given-names>
          </name>
          <name>
            <surname>Bhardwaj</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Involvement of Asada-Halliwell Pathway During Phytoremediation of Chromium (VI)</article-title>
          <date>
            <year>2015</year>
          </date>
          <chapter-title>in Brassica juncea L. Plants, International journal of phytoremediation</chapter-title>
          <volume>17</volume>
          <fpage>1237</fpage>
          <lpage>1243</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850483852">
        <label>40.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Sharma</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Pati</surname>
            <given-names>P K</given-names>
          </name>
          <name>
            <surname>Bhardwaj</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Regulation of growth and antioxidant enzyme activities by 28-homobrassinolide in seedlings of Raphanus sativus L. under cadmium stress</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>Indian journal of biochemistry &amp; biophysics</source>
          <volume>47</volume>
          <fpage>172</fpage>
          <lpage>177</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850514668">
        <label>41.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Arora</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Bhardwaj</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>Kumar Kanwar</given-names>
          </name>
          <article-title>24-epibrassinolide induced antioxidative defense system of Brassica juncea L. under Zn metal stress, Physiology and molecular biology of plants : an international journal of functional plant biology</article-title>
          <date>
            <year>2010</year>
          </date>
          <volume>16</volume>
          <fpage>285</fpage>
          <lpage>293</lpage>
        <pub-id pub-id-type="doi">10.1007/s12298-010-0031-9</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850512292">
        <label>42.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Bhatnagar-Mathur</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Devi</surname>
            <given-names>M J</given-names>
          </name>
          <name>
            <surname>Vadez</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Sharma</surname>
            <given-names>K K</given-names>
          </name>
          <article-title>Differential antioxidative responses in transgenic peanut bear no relationship to their superior transpiration efficiency under drought stress</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>Journal of plant physiology</source>
          <volume>166</volume>
          <fpage>1207</fpage>
          <lpage>1217</lpage>
        <pub-id pub-id-type="doi">10.1016/j.jplph.2009.01.001</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850463772">
        <label>43.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Stobrawa</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Lorenc-Plucinska</surname>
            <given-names>G</given-names>
          </name>
          <article-title>Thresholds of heavy-metal toxicity in cuttings of European black poplar (Populus nigra L.) determined according to antioxidant status of fine roots and morphometrical disorders, The Science of the total environment</article-title>
          <date>
            <year>2008</year>
          </date>
          <volume>390</volume>
          <fpage>86</fpage>
          <lpage>96</lpage>
        <pub-id pub-id-type="doi">10.1016/j.scitotenv.2007.09.024</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850461972">
        <label>44.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Arican</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Gozukirmizi</surname>
            <given-names>N</given-names>
          </name>
          <article-title>Effects of hyperbaric oxygenation on cultured barley embryos</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>Acta biologica Hungarica</source>
          <volume>59</volume>
          <fpage>453</fpage>
          <lpage>464</lpage>
        <pub-id pub-id-type="doi">10.1556/abiol.59.2008.4.6</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850456284">
        <label>45.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tang</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>M Charles</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>J Newton</given-names>
          </name>
          <article-title>Overexpression of the pepper transcription factor CaPF1 in transgenic Virginia pine (Pinus Virginiana Mill.) confers multiple stress tolerance and enhances organ growth, Plant molecular biology</article-title>
          <date>
            <year>2005</year>
          </date>
          <volume>59</volume>
          <fpage>603</fpage>
          <lpage>617</lpage>
        <pub-id pub-id-type="doi">10.1007/s11103-005-0451-z</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850455420">
        <label>46.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>M</surname>
            <given-names>V Salomon</given-names>
          </name>
          <name>
            <surname>Piccoli</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>I</surname>
            <given-names>Funes Pinter</given-names>
          </name>
          <name>
            <surname>W</surname>
            <given-names>A Stirk</given-names>
          </name>
          <name>
            <surname>Kulkarni</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>van Staden</given-names>
          </name>
          <name>
            <surname>Bottini</surname>
            <given-names>R</given-names>
          </name>
          <article-title>Bacteria and smoke-water extract improve growth and induce the synthesis of volatile defense mechanisms in Vitis vinifera L, Plant physiology and biochemistry : PPB</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>120</volume>
          <fpage>1</fpage>
          <lpage>9</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2017.09.013</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850452036">
        <label>47.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>P</surname>
            <given-names>Y Chen</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names>I Lee</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>C Chen</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>W Juang</given-names>
          </name>
          <article-title>Effects of calcium on rhizotoxicity and the accumulation and translocation of copper by grapevines, Plant physiology and biochemistry :</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>PPB</source>
          <volume>73</volume>
          <fpage>375</fpage>
          <lpage>382</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2013.10.016</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850450452">
        <label>48.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>P</surname>
            <given-names>F Bert</given-names>
          </name>
          <name>
            <surname>Bordenave</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Donnart</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Hevin</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Ollat</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Decroocq</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Mapping genetic loci for tolerance to lime-induced iron deficiency chlorosis in grapevine rootstocks (Vitis sp.), TAG. Theoretical and applied genetics. Theoretische und angewandte</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Genetik</source>
          <volume>126</volume>
          <fpage>451</fpage>
          <lpage>473</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850444548">
        <label>49.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ksouri</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Debez</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Mahmoudi</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Ouerghi</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Gharsalli</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Lachaal</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Genotypic variability within Tunisian grapevine varieties (Vitis vinifera L.) facing bicarbonate-induced iron deficiency, Plant physiology and biochemistry :</article-title>
          <date>
            <year>2007</year>
          </date>
          <source>PPB</source>
          <volume>45</volume>
          <fpage>315</fpage>
          <lpage>322</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2007.03.014</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850442172">
        <label>50.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>A</surname>
            <given-names>R Khan</given-names>
          </name>
          <name>
            <surname>Ullah</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Waqas</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>S Park</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>L Khan</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>J Hong</given-names>
          </name>
          <name>
            <surname>Ullah</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>K Jung</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>E Park</given-names>
          </name>
          <name>
            <surname>Ur-Rehman</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>I</surname>
            <given-names>J Lee</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>H Shin</given-names>
          </name>
          <article-title>Host plant growth promotion and cadmium detoxification in Solanum nigrum, mediated by endophytic fungi, Ecotoxicology and environmental safety, 136;180-188</article-title>
          <date>
            <year>2017</year>
          </date>
        <pub-id pub-id-type="doi">10.1016/j.ecoenv.2016.03.014</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850439076">
        <label>51.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>P</surname>
            <given-names>B Goud</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>S Kachole</given-names>
          </name>
          <article-title>Antioxidant enzyme changes in neem, pigeonpea and mulberry leaves in two stages of maturity</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>Plant signaling &amp; behavior</source>
          <volume>7</volume>
          <fpage>1258</fpage>
          <lpage>1262</lpage>
        <pub-id pub-id-type="doi">10.4161/psb.21584</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850435188">
        <label>52.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Liang</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Ai</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Yu</surname>
            <given-names>D</given-names>
          </name>
          <article-title>Uncovering miRNAs involved in crosstalk between nutrient deficiencies in Arabidopsis, Scientific reports</article-title>
          <date>
            <year>2015</year>
          </date>
          <volume>5</volume>
          <fpage>11813</fpage>
        <pub-id pub-id-type="doi">10.1038/srep11813</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850465716">
        <label>53.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Liang</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>He</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Yu</surname>
            <given-names>D</given-names>
          </name>
          <article-title>Identification of nitrogen starvation-responsive microRNAs in Arabidopsis thaliana</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>PloS one</source>
          <volume>7</volume>
          <fpage>48951</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0048951</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850407396">
        <label>54.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Yamasaki</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Hayashi</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Fukazawa</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Kobayashi</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Shikanai</surname>
            <given-names>T</given-names>
          </name>
          <article-title>SQUAMOSA Promoter Binding Protein-Like7 Is a Central Regulator for Copper Homeostasis in Arabidopsis, The Plant cell</article-title>
          <date>
            <year>2009</year>
          </date>
          <volume>21</volume>
          <fpage>347</fpage>
          <lpage>361</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850405380">
        <label>55.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>S</surname>
            <given-names>E Abdel-Ghany</given-names>
          </name>
          <name>
            <surname>Pilon</surname>
            <given-names>M</given-names>
          </name>
          <article-title>MicroRNA-mediated systemic down-regulation of copper protein expression in response to low copper availability in Arabidopsis</article-title>
          <date>
            <year>2008</year>
          </date>
          <source>The Journal of biological chemistry</source>
          <volume>283</volume>
          <fpage>15932</fpage>
          <lpage>15945</lpage>
        <pub-id pub-id-type="doi">10.1074/jbc.m801406200</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850404300">
        <label>56.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Druege</surname>
            <given-names>U</given-names>
          </name>
          <name>
            <surname>Franken</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Lischewski</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Ahkami</surname>
            <given-names>A H</given-names>
          </name>
          <name>
            <surname>Zerche</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Hause</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>R Hajirezaei</given-names>
          </name>
          <article-title>Transcriptomic analysis reveals ethylene as stimulator and auxin as regulator of adventitious root formation in petunia cuttings, Frontiers in plant science</article-title>
          <date>
            <year>2014</year>
          </date>
          <volume>5</volume>
          <fpage>494</fpage>
        <pub-id pub-id-type="doi">10.3389/fpls.2014.00494</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850398972">
        <label>57.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ahkami</surname>
            <given-names>A H</given-names>
          </name>
          <name>
            <surname>Melzer</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>R Ghaffari</given-names>
          </name>
          <name>
            <surname>Pollmann</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>Ghorbani Javid</given-names>
          </name>
          <name>
            <surname>Shahinnia</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>R Hajirezaei</given-names>
          </name>
          <name>
            <surname>Druege</surname>
            <given-names>U</given-names>
          </name>
          <article-title>Distribution of indole-3-acetic acid in Petunia hybrida shoot tip cuttings and relationship between auxin transport, carbohydrate metabolism and adventitious root formation</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Planta</source>
          <volume>238</volume>
          <fpage>499</fpage>
          <lpage>517</lpage>
        <pub-id pub-id-type="doi">10.1007/s00425-013-1907-z</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850396596">
        <label>58.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ghorecha</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Zheng</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Sunkar</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Krishnayya</surname>
            <given-names>N S R</given-names>
          </name>
          <article-title>MicroRNA dynamics in a wild and cultivated species of Convolvulaceae exposed to drought stress, Physiology and molecular biology of plants : an international journal of functional plant biology</article-title>
          <date>
            <year>2017</year>
          </date>
          <volume>23</volume>
          <fpage>291</fpage>
          <lpage>300</lpage>
        <pub-id pub-id-type="doi">10.1007/s12298-017-0426-y</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850392420">
        <label>59.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Chen</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Li</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Tie</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Chen</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Jin</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Zhai</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Zheng</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Xu</surname>
            <given-names>G</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Liu</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Zhou</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Integrated mRNA and microRNA analysis identifies genes and small miRNA molecules associated with transcriptional and post-transcriptional-level responses to both drought stress and re-watering treatment in tobacco</article-title>
          <date>
            <year>2017</year>
          </date>
          <source>BMC genomics</source>
          <volume>18</volume>
          <fpage>62</fpage>
        <pub-id pub-id-type="doi">10.1186/s12864-016-3372-0</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850387452">
        <label>60.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Roy</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>M Tripathi</given-names>
          </name>
          <name>
            <surname>Yadav</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Mishra</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>S Nautiyal</given-names>
          </name>
          <article-title>Identification and Expression Analyses of miRNAs from Two Contrasting Flower Color Cultivars of Canna by Deep Sequencing</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>PloS one</source>
          <volume>11</volume>
          <fpage>0147499</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0147499</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850384284">
        <label>61.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Shao</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Qiu</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Lu</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Comparative analysis of the Dicer-like gene family reveals loss of miR162 target site</article-title>
          <date>
            <year>2015</year>
          </date>
          <chapter-title>in SmDCL1 from Salvia miltiorrhiza, Scientific reports</chapter-title>
          <volume>5</volume>
          <fpage>9891</fpage>
        <pub-id pub-id-type="doi">10.1038/srep09891</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850381764">
        <label>62.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Fu</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Zhu</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Huang</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Du</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Tian</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>Q</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Xu</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Zhu</surname>
            <given-names>S</given-names>
          </name>
          <article-title>A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment</article-title>
          <date>
            <year>2015</year>
          </date>
          <source>Scientific reports</source>
          <volume>5</volume>
          <fpage>12715</fpage>
        <pub-id pub-id-type="doi">10.1038/srep12715</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850377588">
        <label>63.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Gielen</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Remans</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Vangronsveld</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Cuypers</surname>
            <given-names>A</given-names>
          </name>
          <article-title>Toxicity responses of Cu and Cd: the involvement of miRNAs and the transcription factor SPL7</article-title>
          <date>
            <year>2016</year>
          </date>
          <source>BMC plant biology</source>
          <volume>16</volume>
          <fpage>145</fpage>
        <pub-id pub-id-type="doi">10.1186/s12870-016-0830-4</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850366100">
        <label>64.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Zhao</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Lin</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Qiu</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Cao</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Wen</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Deng</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Wang</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Lin</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Li</surname>
            <given-names>X</given-names>
          </name>
          <date>
            <year>2015</year>
          </date>
          <chapter-title>MicroRNA857 Is Involved in the Regulation of Secondary Growth of Vascular Tissues in Arabidopsis, Plant physiology</chapter-title>
          <fpage>169</fpage>
          <lpage>2539</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850361420">
        <label>65.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Hedayati</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Mousavi</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Razavi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Cultrera</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Alagna</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Mariotti</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Hosseini-Mazinani</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Baldoni</surname>
            <given-names>L</given-names>
          </name>
          <article-title>Polymorphisms in the AOX2 gene are associated with the rooting ability of olive cuttings, Plant cell reports</article-title>
          <date>
            <year>2015</year>
          </date>
          <volume>34</volume>
          <fpage>1151</fpage>
          <lpage>1164</lpage>
        <pub-id pub-id-type="doi">10.1007/s00299-015-1774-0</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850359116">
        <label>66.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Girijashankar</surname>
            <given-names>V</given-names>
          </name>
          <article-title>In vitro regeneration of Eucalyptus camaldulensis, Physiology and molecular biology of plants : an international journal of functional plant biology</article-title>
          <date>
            <year>2012</year>
          </date>
          <volume>18</volume>
          <fpage>79</fpage>
          <lpage>87</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850358396">
        <label>67.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tang</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>J Newton</given-names>
          </name>
          <name>
            <surname>Li</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names>M Charles</given-names>
          </name>
          <article-title>Enhanced stress tolerance in transgenic pine expressing the pepper CaPF1 gene is associated with the polyamine biosynthesis, Plant cell reports</article-title>
          <date>
            <year>2007</year>
          </date>
          <volume>26</volume>
          <fpage>115</fpage>
          <lpage>124</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850354508">
        <label>68.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Tang</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>R</surname>
            <given-names>J Newton</given-names>
          </name>
          <article-title>Polyamines promote root elongation and growth by increasing root cell division in regenerated Virginia pine (Pinus virginiana Mill.) plantlets, Plant cell reports</article-title>
          <date>
            <year>2005</year>
          </date>
          <volume>24</volume>
          <fpage>581</fpage>
          <lpage>589</lpage>
        <pub-id pub-id-type="doi">10.1007/s00299-005-0021-5</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850352924">
        <label>69.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Arias</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Carbonell</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Agusti</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Endogenous free polyamines and their role in fruit set of low and high parthenocarpic ability citrus cultivars</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Journal of plant physiology</source>
          <volume>162</volume>
          <fpage>845</fpage>
          <lpage>853</lpage>
        <pub-id pub-id-type="doi">10.1016/j.jplph.2005.01.011</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850351556">
        <label>70.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>N</surname>
            <given-names>T Dutra</given-names>
          </name>
          <name>
            <surname>Silveira</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Azevedo</surname>
            <given-names>I G de</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>R Gomes-Neto</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>R Facanha</given-names>
          </name>
          <name>
            <surname>Steiner</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>P Guerra</given-names>
          </name>
          <name>
            <surname>E</surname>
            <given-names>I Floh</given-names>
          </name>
          <name>
            <surname>Santa-Catarina</surname>
            <given-names>C</given-names>
          </name>
          <article-title>Polyamines affect the cellular growth and structure of pro-embryogenic masses in Araucaria angustifolia embryogenic cultures through the modulation of proton pump activities and endogenous levels of polyamines</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Physiologia plantarum</source>
          <volume>148</volume>
          <fpage>121</fpage>
          <lpage>132</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850345652">
        <label>71.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>B</surname>
            <given-names>C Chen</given-names>
          </name>
          <name>
            <surname>P</surname>
            <given-names>C Ho</given-names>
          </name>
          <name>
            <surname>K</surname>
            <given-names>W Juang</given-names>
          </name>
          <article-title>Alleviation effects of magnesium on copper toxicity and accumulation in grapevine roots evaluated with biotic ligand models</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>Ecotoxicology</source>
          <volume>22</volume>
          <fpage>174</fpage>
          <lpage>183</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850343420">
        <label>72.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>K</surname>
            <given-names>W Juang</given-names>
          </name>
          <name>
            <surname>Y</surname>
            <given-names>I Lee</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>Y Lai</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>H Wang</given-names>
          </name>
          <name>
            <surname>B</surname>
            <given-names>C Chen</given-names>
          </name>
          <article-title>Copper accumulation, translocation, and toxic effects in grapevine cuttings, Environmental science and pollution research international</article-title>
          <date>
            <year>2012</year>
          </date>
          <volume>19</volume>
          <fpage>1315</fpage>
          <lpage>1322</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850339316">
        <label>73.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Kose</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Erdal</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Kaya</surname>
            <given-names>O</given-names>
          </name>
          <name>
            <surname>Atici</surname>
            <given-names>O</given-names>
          </name>
          <article-title>Comparative evaluation of oxidative enzyme activities during adventitious rooting in the cuttings of grapevine rootstocks</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>Journal of the science of food and agriculture</source>
          <volume>91</volume>
          <fpage>738</fpage>
          <lpage>741</lpage>
        <pub-id pub-id-type="doi">10.1002/jsfa.4244</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850369844">
        <label>74.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Katayama</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Synthesis and biological activities of 4-chloroindole-3-acetic acid and its esters</article-title>
          <date>
            <year>2000</year>
          </date>
          <source>Bioscience, biotechnology, and biochemistry</source>
          <volume>64</volume>
          <fpage>808</fpage>
          <lpage>815</lpage>
        <pub-id pub-id-type="doi">10.1271/bbb.64.808</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850324692">
        <label>75.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>A</surname>
            <given-names>C Nordstrom</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>A Jacobs</given-names>
          </name>
          <name>
            <surname>Eliasson</surname>
            <given-names>L</given-names>
          </name>
          <article-title>Effect of Exogenous Indole-3-Acetic Acid and Indole-3-Butyric Acid on Internal Levels of the Respective Auxins and Their Conjugation with Aspartic Acid during Adventitious Root Formation in Pea Cuttings, Plant physiology</article-title>
          <date>
            <year>1991</year>
          </date>
          <volume>96</volume>
          <fpage>856</fpage>
          <lpage>861</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850322388">
        <label>76.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Fujihara</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Yoneyama</surname>
            <given-names>T</given-names>
          </name>
          <article-title>Endogenous levels of polyamines in the organs of cucumber plant (Cucumis sativus) and factors affecting leaf polyamine contents, Physiologia plantarum</article-title>
          <date>
            <year>2001</year>
          </date>
          <volume>113</volume>
          <fpage>416</fpage>
          <lpage>423</lpage>
        <pub-id pub-id-type="doi">10.1034/j.1399-3054.2001.1130316.x</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850319940">
        <label>77.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Noriega</surname>
            <given-names>X</given-names>
          </name>
          <name>
            <surname>Burgos</surname>
            <given-names>B</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>J Perez</given-names>
          </name>
          <article-title>Short day-photoperiod triggers and low temperatures increase expression of peroxidase RNA transcripts and basic peroxidase isoenzyme activity in grapevine buds</article-title>
          <date>
            <year>2007</year>
          </date>
          <source>Phytochemistry</source>
          <volume>68</volume>
          <fpage>1376</fpage>
          <lpage>1383</lpage>
        <pub-id pub-id-type="doi">10.1016/j.phytochem.2007.02.003</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850317996">
        <label>78.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Mou</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>Yao</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Yang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Zhang</surname>
            <given-names>Y</given-names>
          </name>
          <name>
            <surname>Tian</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Achal</surname>
            <given-names>V</given-names>
          </name>
          <article-title>Plant high tolerance to excess manganese related with root growth, manganese distribution and antioxidative enzyme activity in three grape cultivars, Ecotoxicology and environmental safety</article-title>
          <date>
            <year>2011</year>
          </date>
          <volume>74</volume>
          <fpage>776</fpage>
          <lpage>786</lpage>
        <pub-id pub-id-type="doi">10.1016/j.ecoenv.2010.10.040</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850315836">
        <label>79.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>CT</surname>
            <given-names>da Costa</given-names>
          </name>
          <name>
            <surname>MR</surname>
            <given-names>de Almeida</given-names>
          </name>
          <name>
            <surname>C</surname>
            <given-names>M Ruedell</given-names>
          </name>
          <name>
            <surname>Schwambach</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>F</surname>
            <given-names>S Maraschin</given-names>
          </name>
          <name>
            <surname>A</surname>
            <given-names>G Fett-Neto</given-names>
          </name>
          <article-title>When stress and development go hand in hand: main hormonal controls of adventitious rooting in cuttings, Frontiers in plant science</article-title>
          <date>
            <year>2013</year>
          </date>
          <volume>4</volume>
          <fpage>133</fpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850313100">
        <label>80.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>E</surname>
            <given-names>Santos Macedo</given-names>
          </name>
          <name>
            <surname>H</surname>
            <given-names>G Cardoso</given-names>
          </name>
          <name>
            <surname>Hernandez</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Peixe</surname>
            <given-names>A A</given-names>
          </name>
          <name>
            <surname>Polidoros</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Ferreira</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Cordeiro</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Arnholdt-Schmitt</surname>
            <given-names>B</given-names>
          </name>
          <article-title>Physiologic responses and gene diversity indicate olive alternative oxidase as a potential source for markers involved in efficient adventitious root induction, Physiologia plantarum</article-title>
          <date>
            <year>2009</year>
          </date>
          <volume>137</volume>
          <fpage>532</fpage>
          <lpage>552</lpage>
        <pub-id pub-id-type="doi">10.1111/j.1399-3054.2009.01302.x</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850307628">
        <label>81.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Krahulcova</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Travnicek</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Krahulec</surname>
            <given-names>F</given-names>
          </name>
          <name>
            <surname>Rejmanek</surname>
            <given-names>M</given-names>
          </name>
          <article-title>Small genomes and large seeds: chromosome numbers, genome size and seed mass in diploid Aesculus species (Sapindaceae),Annals of botany, 119;957-964</article-title>
          <date>
            <year>2017</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1850306404">
        <label>82.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Druege</surname>
            <given-names>U</given-names>
          </name>
          <name>
            <surname>Franken</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>M</surname>
            <given-names>R Hajirezaei</given-names>
          </name>
          <article-title>Plant Hormone Homeostasis, Signaling, and Function during Adventitious Root Formation in Cuttings, Frontiers in plant science</article-title>
          <date>
            <year>2016</year>
          </date>
          <volume>7</volume>
          <fpage>381</fpage>
        <pub-id pub-id-type="doi">10.3389/fpls.2016.00381</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850304028">
        <label>83.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Ishida</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Adachi</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Yoshimura</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Shimizu</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Umeda</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Sugimoto</surname>
            <given-names>K</given-names>
          </name>
          <article-title>Auxin modulates the transition from the mitotic cycle to the endocycle in Arabidopsis</article-title>
          <date>
            <year>2010</year>
          </date>
          <source>Development</source>
          <volume>137</volume>
          <fpage>63</fpage>
          <lpage>71</lpage>
        </mixed-citation>
      </ref>
      <ref id="ridm1850300212">
        <label>84.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Boudolf</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Lammens</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Boruc</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>Van Leene</given-names>
          </name>
          <name>
            <surname>Daele</surname>
            <given-names>H Van Den</given-names>
          </name>
          <name>
            <surname>Maes</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>Van Isterdael</given-names>
          </name>
          <name>
            <surname>Russinova</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Kondorosi</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>Witters</surname>
            <given-names>E</given-names>
          </name>
          <name>
            <surname>G</surname>
            <given-names>De Jaeger</given-names>
          </name>
          <name>
            <surname>Inze</surname>
            <given-names>D</given-names>
          </name>
          <name>
            <surname>L</surname>
            <given-names>De Veylder</given-names>
          </name>
          <article-title>CDKB1;1 forms a functional complex with CYCA2;3 to suppress endocycle onset</article-title>
          <date>
            <year>2009</year>
          </date>
          <source>Plant physiology</source>
          <volume>150</volume>
          <fpage>1482</fpage>
          <lpage>1493</lpage>
        <pub-id pub-id-type="doi">10.1104/pp.109.140269</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850294164">
        <label>85.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Breuer</surname>
            <given-names>C</given-names>
          </name>
          <name>
            <surname>Ishida</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Sugimoto</surname>
            <given-names>K</given-names>
          </name>
          <article-title>Developmental control of endocycles and cell growth in plants, Current opinion in plant biology</article-title>
          <date>
            <year>2010</year>
          </date>
          <volume>13</volume>
          <fpage>654</fpage>
          <lpage>660</lpage>
        <pub-id pub-id-type="doi">10.1016/j.pbi.2010.10.006</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850292508">
        <label>86.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Wildwater</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Campilho</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>J</surname>
            <given-names>M Perez-Perez</given-names>
          </name>
          <name>
            <surname>Heidstra</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Blilou</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Korthout</surname>
            <given-names>H</given-names>
          </name>
          <name>
            <surname>Chatterjee</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Mariconti</surname>
            <given-names>L</given-names>
          </name>
          <name>
            <surname>Gruissem</surname>
            <given-names>W</given-names>
          </name>
          <name>
            <surname>Scheres</surname>
            <given-names>B</given-names>
          </name>
          <article-title>The RETINOBLASTOMA-RELATED gene regulates stem cell maintenance in Arabidopsis roots</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Cell</source>
          <volume>123</volume>
          <fpage>1337</fpage>
          <lpage>1349</lpage>
        <pub-id pub-id-type="doi">10.1016/j.cell.2005.09.042</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850288620">
        <label>87.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Blilou</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Xu</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Wildwater</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Willemsen</surname>
            <given-names>V</given-names>
          </name>
          <name>
            <surname>Paponov</surname>
            <given-names>I</given-names>
          </name>
          <name>
            <surname>Friml</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Heidstra</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Aida</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Palme</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Scheres</surname>
            <given-names>B</given-names>
          </name>
          <article-title>The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots</article-title>
          <date>
            <year>2005</year>
          </date>
          <source>Nature</source>
          <volume>433</volume>
          <fpage>39</fpage>
          <lpage>44</lpage>
        <pub-id pub-id-type="doi">10.1038/nature03184</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850285812">
        <label>88.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Vuosku</surname>
            <given-names>J</given-names>
          </name>
          <name>
            <surname>Suorsa</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Ruottinen</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Sutela</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Muilu-Makela</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Julkunen-Tiitto</surname>
            <given-names>R</given-names>
          </name>
          <name>
            <surname>Sarjala</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Neubauer</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Haggman</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Polyamine metabolism during exponential growth transition in Scots pine embryogenic cell culture</article-title>
          <date>
            <year>2012</year>
          </date>
          <source>Tree physiology</source>
          <volume>32</volume>
          <fpage>1274</fpage>
          <lpage>1287</lpage>
        <pub-id pub-id-type="doi">10.1093/treephys/tps088</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850281564">
        <label>89.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Sarjala</surname>
            <given-names>T</given-names>
          </name>
          <name>
            <surname>Niemi</surname>
            <given-names>K</given-names>
          </name>
          <name>
            <surname>Haggman</surname>
            <given-names>H</given-names>
          </name>
          <article-title>Mycorrhiza formation is not needed for early growth induction and growth-related changes in polyamines</article-title>
          <date>
            <year>2010</year>
          </date>
          <chapter-title>in Scots pine seedlings in vitro, Plant physiology and biochemistry : PPB</chapter-title>
          <volume>48</volume>
          <fpage>596</fpage>
          <lpage>601</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2010.01.022</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850278324">
        <label>90.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Hajyzadeh</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Turktas</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Khawar</surname>
            <given-names>K M</given-names>
          </name>
          <name>
            <surname>T</surname>
            <given-names/>
          </name>
          <article-title>Unver, miR408 overexpression causes increased drought toleranceinchickpea,Gene, 555;186-193</article-title>
          <date>
            <year>2015</year>
          </date>
        </mixed-citation>
      </ref>
      <ref id="ridm1850274796">
        <label>91.</label>
        <mixed-citation xlink:type="simple" publication-type="book">
          <name>
            <surname>Jovanovic</surname>
            <given-names>Z</given-names>
          </name>
          <name>
            <surname>Stanisavljevic</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Mikic</surname>
            <given-names>A</given-names>
          </name>
          <name>
            <surname>Radovic</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Maksimovic</surname>
            <given-names>V</given-names>
          </name>
          <date>
            <year>2014</year>
          </date>
          <chapter-title>Water deficit down-regulates miR398 and miR408 in pea (Pisum sativum L.), Plant physiology and biochemistry : PPB</chapter-title>
          <volume>83</volume>
          <fpage>26</fpage>
          <lpage>31</lpage>
        <pub-id pub-id-type="doi">10.1016/j.plaphy.2014.07.008</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850272132">
        <label>92.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>R</surname>
            <given-names>D Mutum</given-names>
          </name>
          <name>
            <surname>S</surname>
            <given-names>C Balyan</given-names>
          </name>
          <name>
            <surname>Kansal</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Agarwal</surname>
            <given-names>P</given-names>
          </name>
          <name>
            <surname>Kumar</surname>
            <given-names>S</given-names>
          </name>
          <name>
            <surname>Kumar</surname>
            <given-names>M</given-names>
          </name>
          <name>
            <surname>Raghuvanshi</surname>
            <given-names>S</given-names>
          </name>
          <article-title>Evolution of variety-specific regulatory schema for expression of osa-miR408 in indica rice varieties under drought stress</article-title>
          <date>
            <year>2013</year>
          </date>
          <source>The FEBS journal</source>
          <volume>280</volume>
          <fpage>1717</fpage>
          <lpage>1730</lpage>
        <pub-id pub-id-type="doi">10.1111/febs.12186</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850267740">
        <label>93.</label>
        <mixed-citation xlink:type="simple" publication-type="journal">
          <name>
            <surname>Maunoury</surname>
            <given-names>N</given-names>
          </name>
          <name>
            <surname>Vaucheret</surname>
            <given-names>H</given-names>
          </name>
          <article-title>AGO1 and AGO2 act redundantly in miR408-mediated Plantacyanin regulation</article-title>
          <date>
            <year>2011</year>
          </date>
          <source>PloS one</source>
          <volume>6</volume>
          <fpage>28729</fpage>
        <pub-id pub-id-type="doi">10.1371/journal.pone.0028729</pub-id></mixed-citation>
      </ref>
      <ref id="ridm1850328580">
        <label>94.</label>
        <mixed-citation xlink:type="simple" publication-type="journal"><name><surname>Trindade</surname><given-names>I</given-names></name><name><surname>Capitao</surname><given-names>C</given-names></name><name><surname>Dalmay</surname><given-names>T</given-names></name><name><surname>M</surname><given-names>P Fevereiro</given-names></name><name><surname>D</surname><given-names>M Santos</given-names></name><date><year>2010</year></date><volume>231</volume><fpage>705</fpage><lpage>716</lpage>
miR398 and miR408 are up-regulated in response to water deficit in Medicago truncatula, Planta



</mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>